ptc 1 Search Results


91
Boster Bio ptch1
Ptch1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/Anti-Patched+(A2)+PTCH1+Antibody/pm41330301-83-29-58
Average 91 stars, based on 1 article reviews
ptch1 - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

93
Addgene inc plasmid encoding ptch1 yfp
Plasmid Encoding Ptch1 Yfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/Ptc1-YFP+(Plasmid+%2358456)/pmc09562640-39-12-16
Average 93 stars, based on 1 article reviews
plasmid encoding ptch1 yfp - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
OriGene ptch1 3 utr
Figure 1: <t>PTCH1</t> repression in TMZ-treated GBM cells involved miRNA. U87 and T98G cells were treated with 200 μM TMZ. At 72 h, real time PCR was performed for PTCH1 mRNA (A) and western blot for PTCH1 and SHH (precursor (P) and N-terminus (N)) and β-actin. The values for the untreated group were assigned 1 and are represented by an open bar. The changes in the treated cells were presented as fold change over the vehicle-treated cells. (B) U87 and T98G were knocked down for SHH with siRNA and then analyzed for SHH (precursor, P and mature, N) and β-actin by western blot. (C) The knocked down cells in `C’ were treated with TMZ. At 72 h, the cells were assessed for viability with Cell Titer Blue. The data are presented as the mean % viability relative to vehicle treated siRNA transfected cells ±SD, n = 4. (D) U87 and T98G were knocked down for Dicer1. Control was transfected with non-targeting oligo. Western blot was performed for Dicer. The membrane was stripped and reprobed for β-actin. (E) The cells in `E’ were treated with 200 μM TMZ. At 72 h, western blot was performed for PTCH1. The membrane was stripped and reprobed for β-actin (F) and assessed for viability. (G) p < 0.05 vs. control and non-targeting oligo.
Ptch1 3 Utr, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/PTCH1+(NM_000264)+Human+3'+UTR+Clone/pm25595896-237-6-13
Average 90 stars, based on 1 article reviews
ptch1 3 utr - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

93
Sino Biological vegfr2
Figure 1: <t>PTCH1</t> repression in TMZ-treated GBM cells involved miRNA. U87 and T98G cells were treated with 200 μM TMZ. At 72 h, real time PCR was performed for PTCH1 mRNA (A) and western blot for PTCH1 and SHH (precursor (P) and N-terminus (N)) and β-actin. The values for the untreated group were assigned 1 and are represented by an open bar. The changes in the treated cells were presented as fold change over the vehicle-treated cells. (B) U87 and T98G were knocked down for SHH with siRNA and then analyzed for SHH (precursor, P and mature, N) and β-actin by western blot. (C) The knocked down cells in `C’ were treated with TMZ. At 72 h, the cells were assessed for viability with Cell Titer Blue. The data are presented as the mean % viability relative to vehicle treated siRNA transfected cells ±SD, n = 4. (D) U87 and T98G were knocked down for Dicer1. Control was transfected with non-targeting oligo. Western blot was performed for Dicer. The membrane was stripped and reprobed for β-actin. (E) The cells in `E’ were treated with 200 μM TMZ. At 72 h, western blot was performed for PTCH1. The membrane was stripped and reprobed for β-actin (F) and assessed for viability. (G) p < 0.05 vs. control and non-targeting oligo.
Vegfr2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/PTC1+(CCDC6-RET)%2C+Active/us12209085-2603-23-28
Average 93 stars, based on 1 article reviews
vegfr2 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
Micromass UK Limited prx1-cre : ptc1 c/c
Figure 1: <t>PTCH1</t> repression in TMZ-treated GBM cells involved miRNA. U87 and T98G cells were treated with 200 μM TMZ. At 72 h, real time PCR was performed for PTCH1 mRNA (A) and western blot for PTCH1 and SHH (precursor (P) and N-terminus (N)) and β-actin. The values for the untreated group were assigned 1 and are represented by an open bar. The changes in the treated cells were presented as fold change over the vehicle-treated cells. (B) U87 and T98G were knocked down for SHH with siRNA and then analyzed for SHH (precursor, P and mature, N) and β-actin by western blot. (C) The knocked down cells in `C’ were treated with TMZ. At 72 h, the cells were assessed for viability with Cell Titer Blue. The data are presented as the mean % viability relative to vehicle treated siRNA transfected cells ±SD, n = 4. (D) U87 and T98G were knocked down for Dicer1. Control was transfected with non-targeting oligo. Western blot was performed for Dicer. The membrane was stripped and reprobed for β-actin. (E) The cells in `E’ were treated with 200 μM TMZ. At 72 h, western blot was performed for PTCH1. The membrane was stripped and reprobed for β-actin (F) and assessed for viability. (G) p < 0.05 vs. control and non-targeting oligo.
Prx1 Cre : Ptc1 C/C, supplied by Micromass UK Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/prx1+cre+++ptc1+c+c+micromass+cultures/pmc02934663-780-10-14
Average 90 stars, based on 1 article reviews
prx1-cre : ptc1 c/c - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Johns Hopkins HealthCare patched(ptc1)-lacz reporter gene
Figure 1: <t>PTCH1</t> repression in TMZ-treated GBM cells involved miRNA. U87 and T98G cells were treated with 200 μM TMZ. At 72 h, real time PCR was performed for PTCH1 mRNA (A) and western blot for PTCH1 and SHH (precursor (P) and N-terminus (N)) and β-actin. The values for the untreated group were assigned 1 and are represented by an open bar. The changes in the treated cells were presented as fold change over the vehicle-treated cells. (B) U87 and T98G were knocked down for SHH with siRNA and then analyzed for SHH (precursor, P and mature, N) and β-actin by western blot. (C) The knocked down cells in `C’ were treated with TMZ. At 72 h, the cells were assessed for viability with Cell Titer Blue. The data are presented as the mean % viability relative to vehicle treated siRNA transfected cells ±SD, n = 4. (D) U87 and T98G were knocked down for Dicer1. Control was transfected with non-targeting oligo. Western blot was performed for Dicer. The membrane was stripped and reprobed for β-actin. (E) The cells in `E’ were treated with 200 μM TMZ. At 72 h, western blot was performed for PTCH1. The membrane was stripped and reprobed for β-actin (F) and assessed for viability. (G) p < 0.05 vs. control and non-targeting oligo.
Patched(ptc1) Lacz Reporter Gene, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/mouse+ptc1/10__1038_slash_sj__jid__5603168-166-15-8
Average 90 stars, based on 1 article reviews
patched(ptc1)-lacz reporter gene - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
PTC Therapeutics smn forward c seq id no. 11: ptc1 gatgctgatgctttgggaagt
Figure 1: <t>PTCH1</t> repression in TMZ-treated GBM cells involved miRNA. U87 and T98G cells were treated with 200 μM TMZ. At 72 h, real time PCR was performed for PTCH1 mRNA (A) and western blot for PTCH1 and SHH (precursor (P) and N-terminus (N)) and β-actin. The values for the untreated group were assigned 1 and are represented by an open bar. The changes in the treated cells were presented as fold change over the vehicle-treated cells. (B) U87 and T98G were knocked down for SHH with siRNA and then analyzed for SHH (precursor, P and mature, N) and β-actin by western blot. (C) The knocked down cells in `C’ were treated with TMZ. At 72 h, the cells were assessed for viability with Cell Titer Blue. The data are presented as the mean % viability relative to vehicle treated siRNA transfected cells ±SD, n = 4. (D) U87 and T98G were knocked down for Dicer1. Control was transfected with non-targeting oligo. Western blot was performed for Dicer. The membrane was stripped and reprobed for β-actin. (E) The cells in `E’ were treated with 200 μM TMZ. At 72 h, western blot was performed for PTCH1. The membrane was stripped and reprobed for β-actin (F) and assessed for viability. (G) p < 0.05 vs. control and non-targeting oligo.
Smn Forward C Seq Id No. 11: Ptc1 Gatgctgatgctttgggaagt, supplied by PTC Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/smn+reverse+seq+id+9++ptc1+primer+b+tccagatctgtctgatcgtttctt/us09399649-1284-12-26
Average 90 stars, based on 1 article reviews
smn forward c seq id no. 11: ptc1 gatgctgatgctttgggaagt - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Hypertension Diagnostics Inc ptc1 indices of pressure waveforms
Beat-specific waveforms (gray points) and fitted pressure decay (black lines), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) Two beat-specific waveforms from Figure 2; combined estimates of <t>PTC1</t> and PTC2 are 398 and 75 milliseconds, respectively. B) Two beat-specific waveforms from another participant; combined estimates of PTC1 and PTC2 are 299 and 94 milliseconds, respectively.
Ptc1 Indices Of Pressure Waveforms, supplied by Hypertension Diagnostics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/ptc1+indices+of+pressure+waveforms/pmc07608079-204-75-88
Average 90 stars, based on 1 article reviews
ptc1 indices of pressure waveforms - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
NemaPharm Inc ptc-1(ok122) deletion mutant
Beat-specific waveforms (gray points) and fitted pressure decay (black lines), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) Two beat-specific waveforms from Figure 2; combined estimates of <t>PTC1</t> and PTC2 are 398 and 75 milliseconds, respectively. B) Two beat-specific waveforms from another participant; combined estimates of PTC1 and PTC2 are 299 and 94 milliseconds, respectively.
Ptc 1(ok122) Deletion Mutant, supplied by NemaPharm Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/ptc+1+ok122++deletion+mutant/10__1101_slash_gad__14__15__1933-220-5-13
Average 90 stars, based on 1 article reviews
ptc-1(ok122) deletion mutant - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Millar Inc ptc1 gene
Beat-specific waveforms (gray points) and fitted pressure decay (black lines), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) Two beat-specific waveforms from Figure 2; combined estimates of <t>PTC1</t> and PTC2 are 398 and 75 milliseconds, respectively. B) Two beat-specific waveforms from another participant; combined estimates of PTC1 and PTC2 are 299 and 94 milliseconds, respectively.
Ptc1 Gene, supplied by Millar Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/ptc1+gene/pmc03273383-29-20-37
Average 90 stars, based on 1 article reviews
ptc1 gene - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc custom-made primers directed against gfp, mouse shh and mouse patched1 (ptc1)
Beat-specific waveforms (gray points) and fitted pressure decay (black lines), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) Two beat-specific waveforms from Figure 2; combined estimates of <t>PTC1</t> and PTC2 are 398 and 75 milliseconds, respectively. B) Two beat-specific waveforms from another participant; combined estimates of PTC1 and PTC2 are 299 and 94 milliseconds, respectively.
Custom Made Primers Directed Against Gfp, Mouse Shh And Mouse Patched1 (Ptc1), supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/custom+made+primers+directed+against+gfp++mouse+shh+and+mouse+patched1++ptc1+/pmc03303093-113-6-15
Average 90 stars, based on 1 article reviews
custom-made primers directed against gfp, mouse shh and mouse patched1 (ptc1) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Abnova anti-ol-ptc1 antibody
Beat-specific waveforms (gray points) and fitted pressure decay (black lines), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) Two beat-specific waveforms from Figure 2; combined estimates of <t>PTC1</t> and PTC2 are 398 and 75 milliseconds, respectively. B) Two beat-specific waveforms from another participant; combined estimates of PTC1 and PTC2 are 299 and 94 milliseconds, respectively.
Anti Ol Ptc1 Antibody, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptc+1/anti+ol+ptc1+antibody/pm20578184-86-1-8
Average 90 stars, based on 1 article reviews
anti-ol-ptc1 antibody - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Figure 1: PTCH1 repression in TMZ-treated GBM cells involved miRNA. U87 and T98G cells were treated with 200 μM TMZ. At 72 h, real time PCR was performed for PTCH1 mRNA (A) and western blot for PTCH1 and SHH (precursor (P) and N-terminus (N)) and β-actin. The values for the untreated group were assigned 1 and are represented by an open bar. The changes in the treated cells were presented as fold change over the vehicle-treated cells. (B) U87 and T98G were knocked down for SHH with siRNA and then analyzed for SHH (precursor, P and mature, N) and β-actin by western blot. (C) The knocked down cells in `C’ were treated with TMZ. At 72 h, the cells were assessed for viability with Cell Titer Blue. The data are presented as the mean % viability relative to vehicle treated siRNA transfected cells ±SD, n = 4. (D) U87 and T98G were knocked down for Dicer1. Control was transfected with non-targeting oligo. Western blot was performed for Dicer. The membrane was stripped and reprobed for β-actin. (E) The cells in `E’ were treated with 200 μM TMZ. At 72 h, western blot was performed for PTCH1. The membrane was stripped and reprobed for β-actin (F) and assessed for viability. (G) p < 0.05 vs. control and non-targeting oligo.

Journal: Oncotarget

Article Title: Temozolomide resistance in glioblastoma occurs by miRNA-9-targeted PTCH1, independent of sonic hedgehog level.

doi: 10.18632/oncotarget.2778

Figure Lengend Snippet: Figure 1: PTCH1 repression in TMZ-treated GBM cells involved miRNA. U87 and T98G cells were treated with 200 μM TMZ. At 72 h, real time PCR was performed for PTCH1 mRNA (A) and western blot for PTCH1 and SHH (precursor (P) and N-terminus (N)) and β-actin. The values for the untreated group were assigned 1 and are represented by an open bar. The changes in the treated cells were presented as fold change over the vehicle-treated cells. (B) U87 and T98G were knocked down for SHH with siRNA and then analyzed for SHH (precursor, P and mature, N) and β-actin by western blot. (C) The knocked down cells in `C’ were treated with TMZ. At 72 h, the cells were assessed for viability with Cell Titer Blue. The data are presented as the mean % viability relative to vehicle treated siRNA transfected cells ±SD, n = 4. (D) U87 and T98G were knocked down for Dicer1. Control was transfected with non-targeting oligo. Western blot was performed for Dicer. The membrane was stripped and reprobed for β-actin. (E) The cells in `E’ were treated with 200 μM TMZ. At 72 h, western blot was performed for PTCH1. The membrane was stripped and reprobed for β-actin (F) and assessed for viability. (G) p < 0.05 vs. control and non-targeting oligo.

Article Snippet: The reporter gene vector containing the PTCH1 3′ UTR was custom ordered from Origene Technologies (Rockville, MD).

Techniques: Real-time Polymerase Chain Reaction, Western Blot, Transfection, Control, Membrane

Figure 2: Increased miR-9 in GBM. (A) Computational analyses were performed for potential miRNA interacting site with the PTCH1 3ʹ UTR. The alignment between the sequence for miR-9 and the 3ʹ UTR of PTCH1 is shown below. (B) U87 and T98G cells were treated with 200 μM TMZ. At various times, real time PCR (Taqman) was performed for miR-9. (C) The studies in `C’ were repeated, except for studies at the 72-h time point, and with primers for miR-9-2, using Sybr-Green. (D) U87 and T98G were transfected with non- targeting oligo or anti-miR-9 and then treated with 200 μM TMZ. After 72 h, cell viability was assessed and presented as % viability, n = 4 ±SD. (E) The heat map shows the analyses from 505 miRNA arrays with GBM tissues from The Cancer Genome Atlas (TCGA). The map represents the miRNAs with +/– 0.5-fold changes from the internal control. Arrow highlights the output for miR-9. *p < 0.05 vs. other time points, **p < 0.05 vs. vehicle. ***p < 0.05 vs. non-targeting oligo.

Journal: Oncotarget

Article Title: Temozolomide resistance in glioblastoma occurs by miRNA-9-targeted PTCH1, independent of sonic hedgehog level.

doi: 10.18632/oncotarget.2778

Figure Lengend Snippet: Figure 2: Increased miR-9 in GBM. (A) Computational analyses were performed for potential miRNA interacting site with the PTCH1 3ʹ UTR. The alignment between the sequence for miR-9 and the 3ʹ UTR of PTCH1 is shown below. (B) U87 and T98G cells were treated with 200 μM TMZ. At various times, real time PCR (Taqman) was performed for miR-9. (C) The studies in `C’ were repeated, except for studies at the 72-h time point, and with primers for miR-9-2, using Sybr-Green. (D) U87 and T98G were transfected with non- targeting oligo or anti-miR-9 and then treated with 200 μM TMZ. After 72 h, cell viability was assessed and presented as % viability, n = 4 ±SD. (E) The heat map shows the analyses from 505 miRNA arrays with GBM tissues from The Cancer Genome Atlas (TCGA). The map represents the miRNAs with +/– 0.5-fold changes from the internal control. Arrow highlights the output for miR-9. *p < 0.05 vs. other time points, **p < 0.05 vs. vehicle. ***p < 0.05 vs. non-targeting oligo.

Article Snippet: The reporter gene vector containing the PTCH1 3′ UTR was custom ordered from Origene Technologies (Rockville, MD).

Techniques: Sequencing, Real-time Polymerase Chain Reaction, SYBR Green Assay, Transfection, Control

Figure 3: MiR-9 targets PTCH1 and activates SHH signaling and drug transporters. (A & B) CCL64, stably transfected with pPTCH-UTR-JM, was transiently transfected with pre-miR-9, non-targeting oligo and/or target protection (TP) oligo. After 48 h, luciferase activities were quantitated and then presented as normalized luciferase ±SD, n = 4; TP: Target Protector (A). Western blots were performed with whole cell extracts for PTCH1 and β-actin. The normalized band densities are shown at the bottom of the images (B). (C) U87 and T98G, stably transfected with pPTCH-UTR-JM or pPTCH-UTR∆-JM, were transiently transfected with anti-miR-9 and then treated with 200 μM TMZ or vehicle. After 48 h, luciferase activities were quantitated and the results are presented as mean RLU ±SD, n = 4. (D & E) MiR-9 was ectopically expressed in U87 and T98G cells. Total RNA was isolated and then studied by real time PCR for PTCH1 mRNA (D) or Gli1 (E). (F) Diagram show increased miR-9 in TMZ-treated GBM cells leading to activated SHH signaling. (G) Western blots with whole cell extracts were performed for Gli1, PTCH1 and β-actin using miR-9-transfected or vector-transfected GBM cells. (H–K) U87 and T98G cells were ectopically expressed for miR-9 or transfected with vector alone. Real-time PCR was performed for MDR1 (H) and ABCG2 (I). The values for control vector in the real time were normalized to 1 for fold-change of the miR-9 transfectants, mean±SD, n = 4; flow cytometry for membrane MDR1 (J) and ABCG2 (K). *p < 0.05 vs. Pre-mir-9 and TP, **p < 0.05 vs. pPTCH-UTR-JM. ***p < 0.05 vs. vector alone.

Journal: Oncotarget

Article Title: Temozolomide resistance in glioblastoma occurs by miRNA-9-targeted PTCH1, independent of sonic hedgehog level.

doi: 10.18632/oncotarget.2778

Figure Lengend Snippet: Figure 3: MiR-9 targets PTCH1 and activates SHH signaling and drug transporters. (A & B) CCL64, stably transfected with pPTCH-UTR-JM, was transiently transfected with pre-miR-9, non-targeting oligo and/or target protection (TP) oligo. After 48 h, luciferase activities were quantitated and then presented as normalized luciferase ±SD, n = 4; TP: Target Protector (A). Western blots were performed with whole cell extracts for PTCH1 and β-actin. The normalized band densities are shown at the bottom of the images (B). (C) U87 and T98G, stably transfected with pPTCH-UTR-JM or pPTCH-UTR∆-JM, were transiently transfected with anti-miR-9 and then treated with 200 μM TMZ or vehicle. After 48 h, luciferase activities were quantitated and the results are presented as mean RLU ±SD, n = 4. (D & E) MiR-9 was ectopically expressed in U87 and T98G cells. Total RNA was isolated and then studied by real time PCR for PTCH1 mRNA (D) or Gli1 (E). (F) Diagram show increased miR-9 in TMZ-treated GBM cells leading to activated SHH signaling. (G) Western blots with whole cell extracts were performed for Gli1, PTCH1 and β-actin using miR-9-transfected or vector-transfected GBM cells. (H–K) U87 and T98G cells were ectopically expressed for miR-9 or transfected with vector alone. Real-time PCR was performed for MDR1 (H) and ABCG2 (I). The values for control vector in the real time were normalized to 1 for fold-change of the miR-9 transfectants, mean±SD, n = 4; flow cytometry for membrane MDR1 (J) and ABCG2 (K). *p < 0.05 vs. Pre-mir-9 and TP, **p < 0.05 vs. pPTCH-UTR-JM. ***p < 0.05 vs. vector alone.

Article Snippet: The reporter gene vector containing the PTCH1 3′ UTR was custom ordered from Origene Technologies (Rockville, MD).

Techniques: Stable Transfection, Transfection, Luciferase, Western Blot, Isolation, Real-time Polymerase Chain Reaction, Plasmid Preparation, Control, Flow Cytometry, Membrane

Figure 4: Expressions of PTCH1, miR-9-2 and drug transporters in naïve and recurrent GBM cells from patients. (A) Real-time PCR was performed for the miRNA, predicted for PTCH1 (Figure 2A). The results are presented as the mean fold change ±SD, n = 4. (B) Real time PCR for miR-9-2 was performed in four independent studies using RNA from BT145 and BT164 cells. The results of BT145 were normalized to 1 and then used to calculate the fold change for the values of BT164, mean±SD. (C) Real time PCR were performed for PTCH1 as for `B’ and the results are similarly presented. (D) Whole cell extracts from BT145 and BT164 were studied by western blot for PTCH1, SHH-P (precursor), SHH-N (mature) and β-actin. (E) Real time PCR was performed for MDR1 and ABCG2 mRNA with total RNA from BT145 and BT164. (F & G) Flow cytometry was performed for membrane P-glycoprotein (MDR1) (F) and ABCG2 (G). The right panels show the overlay between the two patients. *p < 0.05 vs. BT145.

Journal: Oncotarget

Article Title: Temozolomide resistance in glioblastoma occurs by miRNA-9-targeted PTCH1, independent of sonic hedgehog level.

doi: 10.18632/oncotarget.2778

Figure Lengend Snippet: Figure 4: Expressions of PTCH1, miR-9-2 and drug transporters in naïve and recurrent GBM cells from patients. (A) Real-time PCR was performed for the miRNA, predicted for PTCH1 (Figure 2A). The results are presented as the mean fold change ±SD, n = 4. (B) Real time PCR for miR-9-2 was performed in four independent studies using RNA from BT145 and BT164 cells. The results of BT145 were normalized to 1 and then used to calculate the fold change for the values of BT164, mean±SD. (C) Real time PCR were performed for PTCH1 as for `B’ and the results are similarly presented. (D) Whole cell extracts from BT145 and BT164 were studied by western blot for PTCH1, SHH-P (precursor), SHH-N (mature) and β-actin. (E) Real time PCR was performed for MDR1 and ABCG2 mRNA with total RNA from BT145 and BT164. (F & G) Flow cytometry was performed for membrane P-glycoprotein (MDR1) (F) and ABCG2 (G). The right panels show the overlay between the two patients. *p < 0.05 vs. BT145.

Article Snippet: The reporter gene vector containing the PTCH1 3′ UTR was custom ordered from Origene Technologies (Rockville, MD).

Techniques: Real-time Polymerase Chain Reaction, Western Blot, Flow Cytometry, Membrane

Beat-specific waveforms (gray points) and fitted pressure decay (black lines), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) Two beat-specific waveforms from Figure 2; combined estimates of PTC1 and PTC2 are 398 and 75 milliseconds, respectively. B) Two beat-specific waveforms from another participant; combined estimates of PTC1 and PTC2 are 299 and 94 milliseconds, respectively.

Journal: American Journal of Epidemiology

Article Title: PTC1 and PTC2: New Indices of Blood Pressure Waveforms and Cardiovascular Disease

doi: 10.1093/aje/kwz280

Figure Lengend Snippet: Beat-specific waveforms (gray points) and fitted pressure decay (black lines), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) Two beat-specific waveforms from Figure 2; combined estimates of PTC1 and PTC2 are 398 and 75 milliseconds, respectively. B) Two beat-specific waveforms from another participant; combined estimates of PTC1 and PTC2 are 299 and 94 milliseconds, respectively.

Article Snippet: The mean difference between repeat measurements was 18 (standard deviation, 222) milliseconds for PTC1 and 1.1 (standard deviation, 22) milliseconds for PTC2 ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Measure Pearson Correlation Coefficient Spearman Correlation Coefficient PTC1 a 0.61 0.75 PTC2 a 0.92 0.87 RC1 b 0.58 0.62 RC2 b 0.74 0.68 SBP 0.90 0.89 DBP 0.86 0.85 Open in a separate window Abbreviations: DBP, diastolic blood pressure; SBP, systolic blood pressure. a PTC1 and PTC2, new indices of pressure waveforms. b RC1 and RC2, from Hypertension Diagnostics, Inc.

Techniques:

Baseline Characteristics ( n = 6,228 Participants), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002

Journal: American Journal of Epidemiology

Article Title: PTC1 and PTC2: New Indices of Blood Pressure Waveforms and Cardiovascular Disease

doi: 10.1093/aje/kwz280

Figure Lengend Snippet: Baseline Characteristics ( n = 6,228 Participants), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002

Article Snippet: The mean difference between repeat measurements was 18 (standard deviation, 222) milliseconds for PTC1 and 1.1 (standard deviation, 22) milliseconds for PTC2 ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Measure Pearson Correlation Coefficient Spearman Correlation Coefficient PTC1 a 0.61 0.75 PTC2 a 0.92 0.87 RC1 b 0.58 0.62 RC2 b 0.74 0.68 SBP 0.90 0.89 DBP 0.86 0.85 Open in a separate window Abbreviations: DBP, diastolic blood pressure; SBP, systolic blood pressure. a PTC1 and PTC2, new indices of pressure waveforms. b RC1 and RC2, from Hypertension Diagnostics, Inc.

Techniques:

Correlation Between Repeat Measurements ( n = 131), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002

Journal: American Journal of Epidemiology

Article Title: PTC1 and PTC2: New Indices of Blood Pressure Waveforms and Cardiovascular Disease

doi: 10.1093/aje/kwz280

Figure Lengend Snippet: Correlation Between Repeat Measurements ( n = 131), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002

Article Snippet: The mean difference between repeat measurements was 18 (standard deviation, 222) milliseconds for PTC1 and 1.1 (standard deviation, 22) milliseconds for PTC2 ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Measure Pearson Correlation Coefficient Spearman Correlation Coefficient PTC1 a 0.61 0.75 PTC2 a 0.92 0.87 RC1 b 0.58 0.62 RC2 b 0.74 0.68 SBP 0.90 0.89 DBP 0.86 0.85 Open in a separate window Abbreviations: DBP, diastolic blood pressure; SBP, systolic blood pressure. a PTC1 and PTC2, new indices of pressure waveforms. b RC1 and RC2, from Hypertension Diagnostics, Inc.

Techniques:

Bland-Altman plots for PTC1 and PTC2 (n = 131), comparing estimates from two 30-second recordings collected on the same day, Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) PTC1, mean of differences = 18 (standard deviation, 222) milliseconds. B) PTC2, mean of differences = 1.1 (standard deviation, 22) milliseconds.

Journal: American Journal of Epidemiology

Article Title: PTC1 and PTC2: New Indices of Blood Pressure Waveforms and Cardiovascular Disease

doi: 10.1093/aje/kwz280

Figure Lengend Snippet: Bland-Altman plots for PTC1 and PTC2 (n = 131), comparing estimates from two 30-second recordings collected on the same day, Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002. A) PTC1, mean of differences = 18 (standard deviation, 222) milliseconds. B) PTC2, mean of differences = 1.1 (standard deviation, 22) milliseconds.

Article Snippet: The mean difference between repeat measurements was 18 (standard deviation, 222) milliseconds for PTC1 and 1.1 (standard deviation, 22) milliseconds for PTC2 ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Measure Pearson Correlation Coefficient Spearman Correlation Coefficient PTC1 a 0.61 0.75 PTC2 a 0.92 0.87 RC1 b 0.58 0.62 RC2 b 0.74 0.68 SBP 0.90 0.89 DBP 0.86 0.85 Open in a separate window Abbreviations: DBP, diastolic blood pressure; SBP, systolic blood pressure. a PTC1 and PTC2, new indices of pressure waveforms. b RC1 and RC2, from Hypertension Diagnostics, Inc.

Techniques: Standard Deviation

Pearson Correlation Between Different Measures at Baseline ( n = 6,228), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002

Journal: American Journal of Epidemiology

Article Title: PTC1 and PTC2: New Indices of Blood Pressure Waveforms and Cardiovascular Disease

doi: 10.1093/aje/kwz280

Figure Lengend Snippet: Pearson Correlation Between Different Measures at Baseline ( n = 6,228), Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002

Article Snippet: The mean difference between repeat measurements was 18 (standard deviation, 222) milliseconds for PTC1 and 1.1 (standard deviation, 22) milliseconds for PTC2 ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Measure Pearson Correlation Coefficient Spearman Correlation Coefficient PTC1 a 0.61 0.75 PTC2 a 0.92 0.87 RC1 b 0.58 0.62 RC2 b 0.74 0.68 SBP 0.90 0.89 DBP 0.86 0.85 Open in a separate window Abbreviations: DBP, diastolic blood pressure; SBP, systolic blood pressure. a PTC1 and PTC2, new indices of pressure waveforms. b RC1 and RC2, from Hypertension Diagnostics, Inc.

Techniques:

Association of Waveform Indices With Events (Hazard Ratios per Standard Deviation a ( n = 6,228)), Median Follow-up 15 Years, Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002

Journal: American Journal of Epidemiology

Article Title: PTC1 and PTC2: New Indices of Blood Pressure Waveforms and Cardiovascular Disease

doi: 10.1093/aje/kwz280

Figure Lengend Snippet: Association of Waveform Indices With Events (Hazard Ratios per Standard Deviation a ( n = 6,228)), Median Follow-up 15 Years, Multi-Ethnic Study of Atherosclerosis, United States, 2000–2002

Article Snippet: The mean difference between repeat measurements was 18 (standard deviation, 222) milliseconds for PTC1 and 1.1 (standard deviation, 22) milliseconds for PTC2 ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Measure Pearson Correlation Coefficient Spearman Correlation Coefficient PTC1 a 0.61 0.75 PTC2 a 0.92 0.87 RC1 b 0.58 0.62 RC2 b 0.74 0.68 SBP 0.90 0.89 DBP 0.86 0.85 Open in a separate window Abbreviations: DBP, diastolic blood pressure; SBP, systolic blood pressure. a PTC1 and PTC2, new indices of pressure waveforms. b RC1 and RC2, from Hypertension Diagnostics, Inc.

Techniques: Standard Deviation